Available online on 15.02.2024 at http://jddtonline.info

Journal of Drug Delivery and Therapeutics

Open Access to Pharmaceutical and Medical Research

Copyright   © 2024 The  Author(s): This is an open-access article distributed under the terms of the CC BY-NC 4.0 which permits unrestricted use, distribution, and reproduction in any medium for non-commercial use provided the original author and source are credited

Open Access  Full Text Article                                                                                                                                                               Review Article

DNA tetrahedron as nanoparticulated delivery system in combating diseases

Ardhendu Kumar Mandal 

Central Instrumentation Division, CSIR-Indian Institute of Chemical Biology, India

Article Info:

_________________________________________________

Article History:

Received 21 Nov 2023      

Reviewed 05 Jan 2024  

Accepted 24 Jan 2024  

Published 15 Feb 2024  

_________________________________________________

Cite this article as: 

Mandal AK, DNA tetrahedron as nanoparticulated delivery system in combating diseases, Journal of Drug Delivery and Therapeutics. 2024; 14(2):178-191

DOI: http://dx.doi.org/10.22270/jddt.v14i2.6326       _________________________________________________

*Address for Correspondence:  

Ardhendu Kumar Mandal, Central Instrumentation Division, CSIR-Indian Institute of Chemical Biology, 4, Raja S.C. Mullick Road, Jadavpur, Kolkata – 700032, India

Abstract

____________________________________________________________________________________________________________

Many diseases suffer from drug resistance and nucleic acid cargo delivery. To optimize pharmaceutics and to enhance their efficiency of cellular uptake, DNA nanomaterial tetrahedrons, owing to their precise control in size, shape, excellent biocompatibility and cellular permeability, reduced cytotoxicity, good stability, ease synthesis and multiple sites for targeting design, have attracted attention for targeting cargos delivery. Their nanostructural binding efficiency with many cargos depends on their electrostatic attractions among free electrons of phosphate oxygen, sugar and base nitrogen. Self-assembled DNA tetrahedrons (DTs) alone also can regulate cellular processes to some extent, especially, on migration, differentiation, proliferation and autophagy, and their modifications with the attachment of aptamers, peptides, nucleic acids, antibodies, different low-molecular-weight drugs and other components, make them a novel targeted delivery system as effective nanomedicine. This review demonstrates the current progress of DTs towards their synthesis, characterization, biomedical applications, biodistribution, elimination and toxicity as possible nanoparticulated delivery system.

Keywords: Diseases; Drug resistance; DNA tetrahedron; nanoparticulated delivery system; Nanomedicine

 

 


 

Introduction

Presently, the demand for developing preventive, predictive and non-invasive patient-oriented medicines as therapeutics is being increased for the treatment of a specific disease with power to leverage qualitative medical care in the life-threatening diseases 1-3. Both biomolecular and chemical drugs as conventional therapy face their obstacles in poor solubility, systemic toxicity, enzymatic degradation, cell membrane-impermeability, drug resistance and non-specific targeting. To overcome these barriers, it is needed to develop active targeted system for delivering drug molecules to specific site of interest. In recent decades, several artificial molecular devices such as applications of viruses, liposomes, polymers, metallic nanomaterials, peptides, proteins, antibody, DNA, siRNA and synthetic inorganic molecules at the nanoscale have been developed to overcome multidrug resistance, therapeutic degradation, cytotoxicity, insolubility of the hydrophobic drugs, cell barricades, and to target cells with higher biological efficiencies and controlled drug release 4-10. Many of these nanotechnology-devices are recently under clinical trials and several are approved by Food and Drug Administration (FDA) as clinical therapeutics for human applications 11. In spite of the advances in the development of the nanotechnology-based delivery system, some of them have still few limitations, such as, short DNAs viral delivery into the cells showing random insertion sites, mutagenesis and cytopathic effects, inherent cytotoxicity and immune toxicity by cationic dendrimers, and cytotoxicity of many non-degraded inorganic nano-elements or residuals in the biological system 12-16. In this context, three-dimensional (3D) DNA-nanotechnology has been emerged as attractive drug delivery system to get maximum efficacy with the minimum toxicity 17. Based on the A-T, G-C Watson-Crick base pairing, natural DNA nanostructure, stabilized by strong hydrogen bond, shows excellent characteristics, such as, precise control in shapes and sizes, non-toxicity and biocompatibility, less susceptibility to nuclease and cell lysate, easy targeting design in multiple sites, and smart cargo delivery 18,19. The most efficient DT, consisting of four or more single-chain DNA self-assembled by base pairing in a specific solution, becomes rigid-structure, highly stable and productive 20,21. As a cargo-carrier, DT exists three main criteria to conjugate cargos, such as, pre-linking of the components mostly nucleic acids at the 5 or 3 end of single strands before self-assembly, decorating of an overhang for not interference with the DT formation following bondage of the materials via the complementary sequence with the overhang, and setting of the components in the DNA double helices by physical conjugates. 

As a nano-sized delivery vehicle, DT may penetrate independently the negatively charged cell-membrane through receptor-mediated endocytotic internalization 22,23 with its inherent capability of resisting nuclease attack to retain its structural integrity for a long time owing to steric hindrance and non-toxic biocompatibility. In this concern, folate or peptide-anchored ligand specific DTs loaded with different cargos by covalent attachments show their efficiencies against tumors 24,25

As monoclonal antibodies have limited capability to liberate drugs for covalent bonding, penetrating cells, immune responsive property and high cost, small peptides mimicking antibodies of smaller sizes and biological specificities like affibody molecules exhibit their efficiencies in drug targeting 26,27. Affibody molecules consisting of three α-helix bundle domains with fifty eight amino acids obtained from the immunoglobulin G protein Z-domain scaffolds lacking cysteins and disulfide bridges are used to form affibody-DT nanoparticles for the treatment of HER2 over-expressing cancers, while DNA-affibody nanoparticles contain one DT and two affibody molecules mimicking one Fc and two Fab regions of the structured antibody for their binding activities 28-33. In addition to acting as a scaffold for anchoring two affibody molecules, DT also is utilized as a carrier to bind multiple small molecular cargos non-covalently for specific targeting. 

Aptamers, short, single stranded DNA and RNA oligonucleotides -ligands, are useful for forming complicated three-dimensional structures with DT, and higher binding capability with a target MUC1 molecule over-expressed in tumor cells 34-37. Furthermore, the binding of tumor-targeting aptamer with a DT through DNA complementary base pairing loaded with drug within its DNA strands may be an effective approach for their specific target drug delivery 21,38-40. When cytosine-phosphate-guanine (CpG) motifs, the short oligonucleotides where 2-deoxycytidine is connected to 2-deoxyguanosine by a phosphodiester bond, are appended to the DNA nanostructures, they show agonist property of Toll-like receptor 9 (TLR9) present in plasmacytoid dendritic cells and B cells through their bindings for boosting the immune response to treat cancer and allergic diseases 41-43. In addition to DNA nanoparticles binding to specific ligands, siRNAs and other cargos also can be loaded for their delivery to specific target site/s 44-47. This review demonstrates mainly the therapeutic efficacies of DT for the treatment of cancer and other diseases to judge as very effective delivery vehicle.

Synthesis and purification of DNA tetrahedron  

DT consists of four isometric single stranded DNAs 21. According to Watson-Crick’s hybridization-principle, each single stranded DNA possesses three blocks utilized for hybridizing with the other three strands respectively to shape rigid DNA helices triangles into one of the DT –sides, with two terminals of oligonucleotides joined covalently at the vertex 48. Each DT –side is splited up by several non-hybridized nucleotides for providing enough flexibility to bend. For the synthesis of DT (Fig.1), each equimolar single stranded DNA sequences is dissolved in 0.5 x TE buffer (10 mmol/L Tris-HCl [pH 8.0] and 50 mmol / L MgCl2) to form one triangle of DTs while every edge is formed through the specific Watson-Crick base pairing by two different single stranded DNAs 49-51, where the corresponding DNA optical density (OD) value is determined at 260 nm by UV Spectrophotometer. In this way, four chains are made with the addition of TE buffer at the same concentration. The mixing ratios of four single strand-DNAs (1:1:1:1) at 1µM / 100 µL in TM buffer is performed for the reaction in a polymerase chain reaction (PCR) machine with the cycling conditions: denatured at 95◦C for 10 min and annealed by natural cooling to 4◦C 21. In this context, all of the single stranded DNAs are purified by HPLC with 260 nm distinctive absorption peak, while the peak time of DNA tetrahedron in the HPLC spectrum becomes faster than that of single strand, and the yield is collected at the accompanying time point.

 image

Figure 1: Schematic diagram of the synthesis of DNA tetrahedrons.


 

 Functionalization of DNA tetrahedron with folate / aptamer / affibody and drug

Free hydrogen groups of drug molecule and folate are modified with azide groups and coupled with 3-OH of single stranded DNAs through click chemistry reactions, while addition of different amounts of functional group tagged single stranded DNAs may stoichiometrically control the ratios of functional groups through specific side chains -hybridization 52. For the synthesis of folate-DT, DT-drug and folate-DT-drug, the molar ratios are set respectively as 1:1, 4:1 and 1:1:3, while all the synthesis are accomplished at micromolar levels at 37◦C, and kept at 4◦C 53 (Fig.2). 


 

 

 

Figure 2: Schematic diagram of DNA tetra-Dox, folic acid-DNA tetra and folic acid-DNA tetra-Dox. S1, S2, S3 and S4 indicate the single stranded DNA sequences of DNA tetrahedron. The figure denotes the process of targeting of inserted DNAs to tumor cells through the cell membrane penetration.


 

Aptamer Sgc8c, a DNA sequence with 42 nucleotides, or other aptamer-modified DNA tetrahedron,  known to bind to cell membrane protein tyrosine kinase 7 (PTK-7) / MUC1 protein over-expressed respectively on human T-cell ALL and tumors / MCF-7 cells may also be fabricated under the same conditions as DTs using aptamer sequences 54-57 (Table 1) (Fig.3).


 

  

Table 1. The specific sequences of each single-stranded DNA. 

Single-stranded DNAs

Directions

Detail sequences

S1

53

ATTTATCACCCGCCATAGTAGACGTATCACCA

GGCAGTTGAGACGAACATTCCTAAGTCTGAA

S2

53

ACATGCGAGGGTCCAATACCGACGATTACAGC

TTGCTACACGATTCAGACTTAGGAATGTTCG

S3

53

ACTACTATGGCGGGTGATAAAACGTGTAGCAA

GCTGTAATCGACGGGAAGAGCATGCCCATCC

S4

53

ACGGTATTGGACCCTCGCATGACTCAACTGC

CTGGTGATACGAGGATGGGCATGCTCTTCCCG

S5

53

ATCTAACTGCTGCGCCGCCGGGAAAATACTGTA

CGGTTAGATTTTTACATGCGAGGGTCCAATACCG

ACGATTACAGCTTGCTACACGATTCAGACTTAGG

AATGTTCG

 

Figure 3: Schematic design of the aptamer-decorated DNA tetrahedron for selective targeting of doxorubicin to MUC1-overexpressed breast cancer cells. Four DNA single strands of DNA tetrahedron with a modified MUC1 aptamer (Apt-tail) indicate strand A, 5- ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA-3, strand B, 5-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC-3, strand C, 5-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC-3, strand D, 5-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT-3 and Apt-tail, 5-AGGAAGAGAGAAGGAAGGGAATTTTTACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA-3. The four DNA single strands have been assembled into a DNA tetrahedron through DNA complementary base pairing. One of the four strands has been extended with a sticky end exposed outside the tetrahedron. The MUC1 aptamer extended with an Apt-tail can pair with the sticky tetrahedron end. The formed aptamer-tetrahedron complex becomes mixed with doxorubicin for forming apt-tetra-dox to bind MCF-7 cancer cells for targeted drug delivery.


 

Two 5-NH2 labeled DNAs (DNA1,2) are dealt with N-maleimidocaproyloxy succinimide ester (EMCS) for generating two N-maleimidocaproyloxy-DNAs (I1,2) 58 (Fig.4). The obtained DNAs are dealt with an affibody containing a cysteine residue at the C-terminus for affording DNA-affibody chimeras (II1,2). The affibody possessing a hexa histidine tag at its N-terminus is explicited in E Coli BL21 cells and purified utilizing a Ni-NTA column 59-61. The coupling reaction yields between I1,2 and the affibody do not differ for the incubation time ranging from 1-5 h. The produced DNA-affibody chimeras are then purified utilizing DEAE-Sepharose CL-6B column for removing the surplus affibody in the reaction mixture following a procedure for oligonucleotides-purification 62. After this chromatography, the un-reacted DNAs in the eluate are removed by Ni-NTA chromatography for specific binding of the hexahistidine peptide to the attached affibody. After purification, the DNA-affibody chimeras are treated with Coomassie Brilliant Blue R-250 and ethidium bromide to stain and detect protein and DNA, respectively. Afterthat, the two pure DNA-affibody chimeras (II1,2) are merged with two single stranded DNAs (DNA3 and DNA4) for forming an affibody-tetrahedron structure (III) containing one DT particle with two affibody molecules. These affibody-tetrahedron structure III particles are incubated with excess drug for non-covalent binding associations at room temperature for 10 min to get DT-affibody-drug nanoparticles (IV) 63, which are purified further utilizing a Sephadex G-25 column to assess the number of drug molecules in the nanoparticles determined by UV-vis spectrophotometry.


 

  

 

Figure 4: Schematic strategy to prepare DNA tetrahedron-affibody nanoparticles (III) and DNA tetrahedron-affibody-drug nanoparticles (IV).


 

Characterization 

To evaluate whether DNA strands and protein are assembled in DT –folate / aptamer / affibody -drug moiety, gel electrophoresis is conducted, followed by ethidium bromide and / or Coomassie Brilliant Blue staining. To determine the structure, size and zeta potential of the DT nanoparticles, atomic force microscopy and a dynamic light scattering study are performed. Transmission electron microscopy may also be preformed for observing the morphology of the DT nanoparticulated moiety.

 

 

 

DNA tetrahedron as delivery vector 

DT can specifically locate and permeate into plasma membrane and deliver cargos mainly through actin-driven clathrin and cavolae -mediated endocytosis as well as macropinocytosis, phagocytosis and clathrin and caveolin -independent endocytosis 64. Its high flexibility in various sizes enables its high capability of cargos-loading with enhanced killing efficacy. The programmability of DT may be modified as vertex, capsule, mosaic and cantilever functional moieties with small molecules, oligonucleotides, antibody, affibody, protein, peptides, ligands and photosensitizers to fulfill suitable targeted therapies such as chemotherapy, immunotherapy, gene silencing and photodynamic therapy 65-67 (Figs.5&6) (Table 2).


 

 

Figure 5: Characteristics of DNA nanostructures for cargo delivery. A. Drug-loading strategies: Cargos may be encapsulated in the nanostructures by ligand recruitment, intercalation, hybridization, entrapment and strand modification. B. Targeting strategies: Drug-loaded nanostructures may be designed to reach specific locations by utilizing cell-specific peptides, aptamers, ligands, antibodies or receptor-specific proteins. C. Strategies for improving biostability: Modifications for improving the stability of DNA nanostructures include nucleotide modifications, ligation of nicks, inter-strand cross-linking, hexane diol and hexaethylene glycol functional groups, and protein or polyethylene glycol -based protective layers.

 

Figure 6: Reconfigurable DNA carriers. The nanostructures may be triggered for releasing the cargos after reaching the target site by (A) an oligonucleotide, complementary to a hairpin nanocarrier region to expand the structure, (B) temperature-triggered nanostructure-expansion, (C) toehold-mediated strand exchang to yield single stranded regions to destabilize the nanocarrier, (D) cytosine-rich strands forming an i-motif at low pH to destabilize the carrier, (E) nanostructures stabilized by photo-labile crosslinkers dissociate on light-exposure to release cargo, (F) nanostructures stabilized by triplex to form oligonicleotide dissociate on pH change, (G) dissociation of nanocarriers owing to aptamer sequences remodeling in sticky ends on recognizing antigens, and (H) primer strands elongation at sticky ends owing to telomerase activity to yield carrier dissociation. Here, modifications have been shown only on the front-faced edges of the tetrahedra.  

Table 2. Modifications and biomedical applications of DNA tetrahedrons in the field of cargos-delivery.

Cargos

Connective

approaches

Modifications

Cell lines

In vitro

In vivo

Ref.

Doxorubicin

Inserting

L-DNA

Aptamer

Aptamer and Folic acid

Tumor-penetrating peptide

D/L-Sugar

Sec7/HeLa

MCF7

HT29

U87MG

Cancer

Yes

No

No

No

Yes

68,69

70

71

25

72

Actinomycin D

Inserting

-

Escherichia coli /

Staphylococcus aureus

No

73

Methylene blue

Inserting

Photodynamic

SCC7

B16F10

MDA-MB231

Yes

68

Pyro

Inserting

Photodynamic

SMMC7721

Yes

67

Floxuridine oligomers

Inserting

Floxuridine oligomers, Cholesterol conjugated ODNs

Colorectal cancer

Yes

74

CpG

Pre-linking

-

RAW 264.7

No

75

CpG ODNs and Streptavidin

Overhang

Biotin-CpG ODNs,      CpG ODNs and Phosphorothioate ODNs

Vaccines

Yes

76

siRNA

Overhang

Folic acid

Tumor targeting ligands and 2׳-O-methyl-ODNs

HeLa

Cancer

Yes

 

24

24

ASOs

Loop

 

 

Inserting

Lipofectamine 2000

 

 

PNA

HeLa 

MCF7

C2C12

Escherichia coli

No

 

 

No

77

 

 

78

Aptamers

Overhang

 

Pre-linking

 

Overhang

 

 

Overhang

-

 

L-DNA

 

-

 

 

Folic acid

HeLa

NIH3T3

NIH3T3

HeLa

A549

MCF7

HT29

HT29

No

 

No

 

No

 

 

No

79

 

80

 

70

 

 

71

 


 

Chemotherapy 

Traditional chemotherapy is utilized to destroy infected or cancerous cells by delivering  small molecular drugs such as doxorubicin, actinomycin D, paclitaxel, cisplatin and adinamycin into infected or tumor tissues specifically through inserting a DNA duplex and hindering the biomolecular biosynthesis associated strong anticancer efficacy with poor selectivity, drug resistance, low uptake and strong adverse effect 81-83. As a promising nanovehicle, cage-like spacious DT, capable in inserting doxorubicin in GC-regions of DNA, showed its higher efficiency compared to free drug to overcome drug resistance avoiding P-glycoprotein and multi drug resistance (MDR) efflux pumps 84. Paclitaxel, capable to promote tumor cell apoptosis through activating the polymerization of microtubules and inhibiting their depolymerization and ending normal mitosis, was conjugated with DT to treat drug resistant tumor cells for getting higher therapeutic efficacy as antitumor agent in comparison to free drug treatment 51,85,86. Actinomycin D loaded DT showed its higher uptake and killing efficiency of bacterial cells after entering cells with its degradation by DNase and liberation of drug by RNA synthesis inhibition 73. An aptamer, a short stretch of single stranded DNA, RNA or polypeptide, having the capability of binding to the corresponding ligand with high specificity and affinity, has been utilized for site specific active cargos targeting. AS1411, a 26-mer DNA aptamer, modified with DNA tetrahedron loaded drug, have been used to treat and kill most efficiently MCF-7 breast cancer cells through the specific binding to nucleolin over-expressed on the surface of tumor cells 25,87,79,88. MUC1 aptamer-guided DNA tetrahedron, hybridized with an extended sequence at one vertex, was utilized for a targeted doxorubicin delivery into Mucin1-positive breast cancer cells 70. SL2B, a 26-mer DNA strand, capable to target specific heparin binding domain (HBD) of vascular endothelial growth factor (VEGF165), after functionalization with doxorubicin loaded DT and folate caused efficient growth inhibition of HT-29 cancer cells through their surface recognition of VEGF and folate receptors 71. Tumor-penetrating peptide (TPP) aptamer, capable to bind neuropilin-1 receptor over-expressed on the surface of U87MG human glioma cells, was anchored to one of the vertices of a DT for forming a conjugate with drug for inhibition of tumor cells proliferation with enhanced cellular uptake and killing efficiency 25,89,90. Nuclear localization signals (NLSs), the amino acid sequences existed in some macromolecular proteins, are needed for some proteins for active transporting to the nucleus through recognition by karyopherins and interacting with nucleoporins. The NLS peptide-modified DNA tetrahedron was utilized to transport to the nucleus of HeLa cells through NLS peptide-specific binding as nuclear targeting from lysosomes to the nucleus 91,23. Nowadays, drug loaded DT modified by two affibody molecules has shown greater selective efficacies in cellular uptake and killing ability towards HER2 over-expressed breast cancer cells compared to free drug 92

Immunotherapy   

Immunotherapy is an effective treatment technique to cure diseased cells chiefly by the stimulation and activation of host immune system 93-95. CpG oligodeoxynucleotides (ODNs), derived from viral or bacterial genomes, are capable to link covalently to the lysine or cysteine residues of an antibody to provide strong immune-stimulatory activities recognized by TLR9 96-99. Phosphorothiolate modified CpG-DT having stability in serum from enzymatic degradation, showed its higher target efficiency and strong immune response in macrophage-like RAW264.7 cells 75. The small biotin (vitamin H) molecule, exhibiting a strong binding affinity with avidin or streptavidin protein, may be utilized for site specific loading of cargos in DNA assemblies and their site-selective cellular uptake and controlled release 100-102. In this context, biotinylated DNA tetrahedron was also used as vehicle to deliver antigen streptavidin into mice to stimulate strong and continuous antibody responses against the antigen compared to free antigen relating DNA-based delivery system for synthetic vaccines 76. Furthermore, DNA tetrahedron was utilized as a platform to prepare another type of synthetic vaccines where DT, modified with streptavidin antigen and CpG ODNs-adjuvant, delivered both assembled antigen and adjuvant to diseased cells, followed with the higher level of anti-streptavidin IgGs and the induction of effective immune responses triggering the secretions of IL-6, IL-12 and TNF-α to induct cancer cell apoptosis and necrosis 76,103

Gene therapy 

Therapeutic ODNs such as small interfering RNAs (siRNAs), micro RNAs (miRNAs), antisense oligonecleotides (ASOs) and CRISPR-Cas9, are capable to target their genes following various mechanisms with high selectivity for the treatments of disease-related genes 104,105. siRNAs act by targeting and inducting the cleavage of certain complementary mRNAs leading to the shutdown of the expressions of mRNA-encoded proteins within the eukaryotic RNA interference (RNAi) pathway 106. DT, hybridized with siRNA and decorated with the folate molecules, showed their higher selective delivery-efficacy of siRNAs and gene silencing in vivo in tumors 24. Similarly, miRNAs, loaded on DNA nanostructures through hybridization, exhibited their therapeutic efficacies by suppressing tumor growth and blocking cell invasion and metastasis 107,108. DT, modified with anti-bla CTX-M-group1 antisense PNA (PNA4), showed reduced inhibitory concentration (to CTX) of E. coli carrying bla CTX-M-3 78. CRISPR-Cas9, a prokaryotic immune system, utilized to resist foreign plasmid and phage DNAs, acts through the recognition of complementary DNA sequences flanked by a 5-NGGPAM motif by a single guide RNA (sgRNA) for directing Cas9 to cleave the recognized DNA 109-112. In this concern, DNA nanostructures are being designed with Cas9/sgRNA for their efficient therapeutic deliveries as future human therapeutics 113,114.

Photodynamic therapy

Photodynamic therapy (PDT), a cytotoxic treatment utilized to kill cancer cells by the liberation of singlet oxygen upon irradiation of photosensitized drugs 115,116. Doxorubicin loaded and pyropheophorbide (pyro) attached DT showed its synergistic efficacies not only to destroy target tumor cells by disturbing gene biosynthesis but also to brighten targeted cells and produce cytotoxic singlet oxygen upon light irradiation 67. Differently, fluorescent methylene blue loaded DT exhibited its higher therapeutic uptake and cell cytotoxic efficiencies in tumor, propotional to the amount of delivered methylene blue 68.  Furthermore, fabrication of DNA nanostructure with metallic gold nanoparticles exhibited higher cellular accumulation with enhanced antitumor efficacy in tumor cells through photothermal ablation 117-119.

Biodistribution, pharmacokinetics and elimination

All the factors such as size, shape, susceptibility to digestion by enzymes, attachment of ligands, encapsulation, animal model and routes of administration of DNA nanostructures influence their blood residence, tissue distribution and mechanisms of elimination. The labeled tetrahedral nanostructures decorated with folate ligands and loaded with siRNA were exploited to treat tumor through attaching folate receptors over-expressed in Luc-KB cells 24,120. The in vivo fluorescence molecular computed tomography in a Luc-KB xenograft model in athymic Balb/c mice after intravenous injection from 5 min to 24 h and 12 h post injection ex vivo organ fluorescence analysis showed that the targeted nanostructures were accumulated primarily in the tumor and kidney and a little accumulation in the liver, spleen, lung or heart. The blood half-life of the nanostructures was ~25 min which was longer than the administered siRNA alone (~6 min). The half-life of the tetrahedrons was longer possibly due to the enhancement in their hydrodynamic radius size caused by the appended siRNA ligands from normal ~7 nm per edge to ~20 nm. Another folate-anchored tetrahedral nanostructures labeled with a near-infrared (NIR) emitter and a radioactive isotope for single-photon emission computed tomography (SPECT) imaging and ex vivo analysis showed a greater accumulation in the tumors especially for the folate receptors and less in the stomach, spleen, lungs and heart, whereas free tetrahedrons bearing only the NIR emitter after intravenous injection exhibited their accumulation in the bladder within few minutes with a blood half-life of ~5-3 min in normal healthy ICR mice 121. The high resolution of SPECT imaging exhibited the accumulation of the nanostructures in the gallbladder and intestines after 2 h intravenous injection, whereas combined NIR and SPECT analysis showed their major accumulation in the bladder within 2 h of intravenous injection 122. The intravenous injection of biotinylated DT loaded with ruthenium polypyridyl complexes (RuPOP) into nude Balb/c mice bearing HEPG2 tumors exhibited the accumulation of nanostructures primarily in the tumor cells after 6 h injection, assessed by the fluorescence imaging from 6-24 h. After 24 h, the accumulation was also observed in the mice liver 123

The in vivo administered DNA nanostructures are internalized into cells by endocytosis and phagocytosis and degraded in phagolysosomal compartment by lysozymes, DNases, metabolized in liver, degraded in the blood, extracellular milieu and other cells by nucleases specifically at pH 8.0 18,124,125. They undergo biliary excretion and kidney elimination through glomerular filtration (< 5 nm diameter), while larger particles may be sequestered in tissue for longer time or re-entered into the systemic circulation in reduced sizes 16,122.

Toxicity

DT nanostructures decorated with folate ligands and siRNAs showed a minimal immune response of marker IFN-α secretion in the blood after 6 h post intravenous injection in C57BL/6 mice 24. RuPOP loaded biotinylated DT exhibited normal levels of blood biochemical parameters compared to tumor free mice based on the estimations of glucose, aspartate aminotransferase, alanine aminotransferase, total protein, globulin, albumin, albumin-globulin, urea, creatinine, high and low -density lipoproteins, cholesterol, triglyceride, creatine kinase and lactate dehydrogenase in a HEPG2 xenograft model of Balb/c nude mice injected every 2 days for a total of 28 days 123. The ex vivo tissue histopathology exhibited minimum cellular damage, while administration of the RuPOP alone caused pulmonary hemorrhage, indicating DNA nanostructures had insignificant cellular toxicity as a drug delivery carrier. 

Conclusions and future perspectives

In general, linear DNA nanostructures are vulnerable to nucleases and lysozymes in cytoplasm and serum, associated with low ionic concentration and pH8.0. However, non-immunogenic three dimensional programmable structures of DT have made them more resistant to easier disassembly, while L-DNA shows more stability than natural D-DNA 68. For passive targeting, L/D –DT loaded with cargos and / or coated with poly ethylene glycol (PEG) or other vesicles may be more effective due to their favorable site-oriented targeting, membrane penetration capability, suitable biostability and biocompatibility as delivery vehicle to destroy diseased cells 68,72,126. For active targeting, DTs may also be decorated with small molecules, ligands and cargos to conjugate, intercalate, encapsulate or bind covalently or non-covalently for enhancing their biostability, elonging their circulation time and changing their appropriate surface and mechanical features to reach to specific target cells. In this context, a thorough systematic investigation specifically on prolonged repeated doses regarding bio-distribution, pharmacokinetics, eliminations, toxicities and effective biological efficiencies especially for oral and intravenous administrations for all differently functionalized DTs in in vivo animal models is needed for their proper pharmaceutical and biomedical applications as future therapeutic nanomedicine in clinics to benefit the human beings.

Conflict of interests 

The author declares no conflicts of interest.

Acknowledgement 

This study was supported by the Council of Scientific and Industrial Research (CSIR), Government of India.

References

1. Subbiah V. The next generation of evidence-based medicine. Nat Med. 2023; 29:49-58. https://doi.org/10.1038/s41591-022-02160-z PMid:36646803

2. Pene F, Courtine E, Cariou A, Mira JP. Toward theranostics. Crit Care Med. 2009; 37:S50-S58. https://doi.org/10.1097/CCM.0b013e3181921349 PMid:19104225

3. Janib SM, Moses AS, MacKay JA. Imaging and drug delivery using theranostic nanoparticles. Adv Drug Deliv Rev. 2010; 62: 1052-63. https://doi.org/10.1016/j.addr.2010.08.004 PMid:20709124 PMCid:PMC3769170

4. Chehelgerdi M, Chehelgerdi M, Allela OQB, Pecho RDC, Jayasankar N, Rao DP, et al. Progressing nanotechnology to improve targeted cancer treatment: Overcoming hurdles in its clinical implementation. Mol Cancer. 2023; 22:169. https://doi.org/10.1186/s12943-023-01865-0 PMid:37814270 PMCid:PMC10561438

5. Hu CMJ, Zhang L, Aryal S, Cheung C, Fang RH, Zhang L. Erythrocyte membrane-camouflaged polymeric nanoparticles as a biomimetic delivery platform. Proc Natl Acad Sci USA. 2011; 108:10980-85. https://doi.org/10.1073/pnas.1106634108 PMid:21690347 PMCid:PMC3131364

6. Campora S, Ghersi G. Recent developments and applications of smart nanoparticles in biomedicine. Nanotechnol Rev. 2022; 11:2595-631. https://doi.org/10.1515/ntrev-2022-0148

7. Al-Jamal WT, Kostarelos K. Liposomes: From a clinically established drug delivery system to a nanoparticle platform for theranostic nanomedicine. Acc Chem Res. 2011; 44:1094-104. https://doi.org/10.1021/ar200105p PMid:21812415

8. Pack DW, Hoffman AS, Pun S, Stayton PS. Design and development of polymers for gene delivery. Nat Rev Drug Discov. 2005; 4:581-93. https://doi.org/10.1038/nrd1775 PMid:16052241

9. Duncan B, Kim C, Rotello VM. Gold nanoparticle platforms as drug and biomacromolecule delivery systems. J Cont Rel. 2010; 148: 122-7. https://doi.org/10.1016/j.jconrel.2010.06.004 PMid:20547192 PMCid:PMC2952284

10. Liu Z, Robinson JT, Tabakman SM, Yang K, Dai H. Carbon materials for drug delivery and cancer therapy. Mater today. 2011; 14: 316-23. https://doi.org/10.1016/S1369-7021(11)70161-4

11. Bobo D, Robinson KJ, Islam J, Theerecht KJ, Corrie SR. Nanoparticle-based medicines: A review of FDA-approved materials and clinical trials to date. Pharm Res. 2016; 33:2373-87. https://doi.org/10.1007/s11095-016-1958-5 PMid:27299311

12. Keles E, Song Y, Du D, Dong WJ, Lin Y. Recent progress in nanomaterials for gene delivery applications. Biomater Sci. 2016; 4: 1291-309. https://doi.org/10.1039/C6BM00441E PMid:27480033

13. Lv H, Zhang S, Wang B, Cui S, Yan J. Toxicity of cationic lipids and cationic polymers in gene delivery. J Cont Rel. 2006; 114: 100-9. https://doi.org/10.1016/j.jconrel.2006.04.014 PMid:16831482

14. Zelphahi O, Uyechi LS, Barron LG, Szoka FC. Effect of serum components on the physic-chemical properties of cationic lipid / oligonucleotide complexes and on their interactions with cells. Biochim Biophys Acta, Lipids lipid Metab. 1998; 1390:119-33. https://doi.org/10.1016/S0005-2760(97)00169-0 PMid:9507083

15. Magrez A, Kasas S, Salicio V, Pasquier N, Seo JW, Celio M, et al. Cellular toxicity of carbon-based nanomaterials. Nano Lett. 2006; 6:1121-25. https://doi.org/10.1021/nl060162e PMid:16771565

16. Mandal AK. Dendrimers in targeted drug delivery applications: A review of diseases and cancer. Int J Polym Mater Polym Biomater. 2021; 70(4):287-97. https://doi.org/10.1080/00914037.2020.1713780

17. Chen JH, Seeman NC. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 1991; 350:631-3. https://doi.org/10.1038/350631a0 PMid:2017259

18. Mei Q, Wei X, Su F, Liu Y, Youngbull C, Johnson R, et al. Stability of DNA origami nanoarrays in cell lysate. Nano Lett. 2011; 11(4):1477-82. https://doi.org/10.1021/nl1040836 PMid:21366226 PMCid:PMC3319871

19. Fakhoury JJ, McLaughlin CK, Edwardson TW, Conway JW, Sleiman HF. Development and characterization of gene silencing DNA cages. Biomacromol. 2014; 15(1):276-82. https://doi.org/10.1021/bm401532n PMid:24328173

20. Goodman RP, Berry RM, Tuberfield AJ. The single-step synthesis of a DNA tetrahedron. Chem Commun. 2004; 12:1372-3. https://doi.org/10.1039/b402293a PMid:15179470

21. Goodman RP, Schaap IA, Tardin CF, Erben CM, Berry RM, Schmidt CF, et al. Rapid chiral assembly of rigid DNA building blocks for molecular nanofabrication. Science. 2005; 310 (5754): 1661-5. https://doi.org/10.1126/science.1120367 PMid:16339440

22. Walsh AS, Yin H, Erben CM, Wood MJA, Turberfield AJ. DNA cage delivery to mammalian cells. ACS Nano. 2011; 5 (7):5427-32. https://doi.org/10.1021/nn2005574 PMid:21696187

23. Liang L, Li J, Li Q, Huamg Q, Shi J, Yan H, et al. Single-particle tracking and modulation of cell entry pathways of a tetrahedral DNA nanostructure in live cells. Angew Chem Int Ed. 2014; 53 (30):7745-50. https://doi.org/10.1002/anie.201403236 PMid:24827912

24. Lee H, Lytton-Jean AK, Chen Y, Love KT, Park AI, Karagiannis ED, et al. Molecularly self-assembled nucleic acid nanoparticles for targeted in vivo siRNA delivery. Nat Nanotechnol. 2012; 7 (6):389-93. https://doi.org/10.1038/nnano.2012.73 PMid:22659608 PMCid:PMC3898745

25. Xia ZW, Wang P, Liu XW, Liu T, Yan YN, Yan J, et al. Tumor-penetrating peptide-modified DNA tetrahedron for targeting drug delivery. Biochem. 2016; 55 (9):1326-31. https://doi.org/10.1021/acs.biochem.5b01181 PMid:26789283

26. Park BW, Zhang HT, Wu C, Berezov A, Zhang X, Dua R, et al. Rationally designed anti-HER2/neu peptide mimetic disables P185HER2/neu tyrosine kinases in vitro and in vivo. Nat Biotechnol. 2000; 18 (2):194-8. https://doi.org/10.1038/72651 PMid:10657127

27. Berezov A, Zhang HT, Greene MI, Murali R. Disabling erbB receptors with rationally designed exocyclic mimetics of antibodies: structure-function analysis. J Med Chem. 2001; 44 (16):2565-74. https://doi.org/10.1021/jm000527m PMid:11472210

28. Nord K, Gunneriusson E, Ringdahl J, Stahl S, Uhlen M, Nygren PA. Binding proteins selected from combinatorial libraries of an alpha-helical bacterial receptor domain. Nat Biotechnol. 1997; 15 (8):772-7. https://doi.org/10.1038/nbt0897-772 PMid:9255793

29. Ronnmark J, Gronlund H, Uhlen M, Nygren PA. Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A. Eur J Biochem. 2002; 269 (11):2647-55. https://doi.org/10.1046/j.1432-1033.2002.02926.x PMid:12047372

30. Orlova A, Rosik D, Sandstrom M, Lundqvist H, Einarsson L, Tolmachev V. Evaluation of [(111/114m)In]CHX-A''-DTPA-ZHER2:342, an affibody ligand coniugate for targeting of HER2-expressing malignant tumors. Q J Nucl Med Mol Imag. 2007; 51 (4):314-23.

31. Tran T, Engfeldt T, Orlova A, Sandstrom M, Feldwisch J, Abrahmsen L, et al. (99m)Tc-maEEE-Z(HER2:342), an Affibody molecule-based tracer for the detection of HER2 expression in malignant tumors. Bioconjugate Chem. 2007; 18 (6):1956-64. https://doi.org/10.1021/bc7002617 PMid:17944527

32. Wikman M, Steffen AC, Gunneriusson E, Tolmachev V, Adams GP, Carlsson J, et al. Selection and characterization of HER2/neu-binding affibody ligands. Protein Eng Des Sel. 2004; 17 (5):455-62. https://doi.org/10.1093/protein/gzh053 PMid:15208403

33. Orlova A, Magnusson M, Eriksson TLJ, Nilsson M, Larsson B, Hoiden-Guthenberg I, et al. Tumor imaging using a picomolar affinity HER2 binding affibody molecule. Cancer Res. 2006; 66 (8):4339-48. https://doi.org/10.1158/0008-5472.CAN-05-3521 PMid:16618759

34. Ferreira CS, Cheung MC, Missailidis S, Bisland S, Gariepy J. Phototoxic aptamers selectively enter and kill epithelial cancer cells. Nucleic acids Res. 2009; 37:866-76. https://doi.org/10.1093/nar/gkn967 PMid:19103663 PMCid:PMC2647295

35. Ferreira CS, Matthews CS, Missailidis S. DNA aptamers that bind to MUC1 tumor marker: design and characterization of MUC1-binding single stranded DNA aptamers. Tumor Biol. 2006; 27:289-301. https://doi.org/10.1159/000096085 PMid:17033199

36. Hu Y, Duan J, Zhan Q, Wang F, Lu X, Yang XD. Novel MUC1 aptamer selectively delivers cytotoxic agent to cancer cells in vitro. PLoS One. 2012; 7:e31970. https://doi.org/10.1371/journal.pone.0031970 PMid:22384115 PMCid:PMC3284512

37. Yu C, Hu Y, Duan J, Yuan W, Wang C, Xu H, et al. Novel aptamer-nanoparticle bioconjugate enhances delivery of anticancer drug to MUC1-positive cancer cells in vitro. PLoS One. 2011; 6:e24077. https://doi.org/10.1371/journal.pone.0024077 PMid:21912664 PMCid:PMC3164674

38. Levy-Nissenbaum E, Radovic-Moreno AF, Wang AZ, Langer R, Farokhzad OC. Nanotechnology and aptamers: applications in drug delivery. Trends Biotechnol. 2008; 26:442-9. https://doi.org/10.1016/j.tibtech.2008.04.006 PMid:18571753

39. Kin KR, Kim Dr, Lee T, Yhee JY, Kim BS, Kwon IC, et al. Drug delivery by a self-assembled DNA tetrahedron for overcoming drug resistance in breast cancer cells. Chem Commun (Camb). 2013; 49:2010-2. https://doi.org/10.1039/c3cc38693g PMid:23380739

40. Bagalkot V, Farokhzad OC, Langer R, Jon S. An aptamer-doxorubicin physical conjugate as a novel targeted drug delivery platform. Angew Chem Int Ed Engl. 2006; 45: 8149-52. https://doi.org/10.1002/anie.200602251 PMid:17099918

41. Weiner GJ, Liu HM, Wooldridge JE, Dahle CE, Krieg AM. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc Natl Acad Sci USA. 1997; 94:10833-37. https://doi.org/10.1073/pnas.94.20.10833 PMid:9380720 PMCid:PMC23500

42. Rottenfusser S, Tuma E, Endres S, Hartmann G. Plasmacytoid dendritic cells: the key to CpG. Hum Immunol. 2002:63:1111-9. https://doi.org/10.1016/S0198-8859(02)00749-8 PMid:12480254

43. Fonseca DE, Kline JN. Use of CpG oligonucleotides in treatment of asthma and allergic disease. Adv Drug Deliv Rev. 2009; 61:256-62. https://doi.org/10.1016/j.addr.2008.12.007 PMid:19167442

44. Kim MG, Park JY, Miao W, Lee J, Oh YK. Polyaptamer DNA nanothread-anchored, reduced graphene oxide nanosheets for targeted delivery. Biomater. 2015; 48:129. https://doi.org/10.1016/j.biomaterials.2015.01.009 PMid:25701038

45. Ni Q, Zhang F, Zhang Y, Zhu G, Wang Z, Teng Z, et al. In situ shRNA synthesis on DNA-poly lactide nanoparticles to treat multidrug resistant breast cancer. Adv Mater. 2018; 30:1705737. https://doi.org/10.1002/adma.201705737 PMid:29333658

46. Zhang Q, Jiang Q, Li N, Dai L, Liu Q, Song L, et al. DNA origami as an in vivo drug delivery vehicle for cancer therapy. ACS Nano. 2014; 8 (7):6633. https://doi.org/10.1021/nn502058j PMid:24963790

47. Bujold KE, Hsu JCC, Sleiman HF. Optimized DNA "Nanosuitcases" for encapsulation and conditional release of siRNA. J Am Chem Soc. 2016; 138(42): 14030-8. https://doi.org/10.1021/jacs.6b08369 PMid:27700075

48. Shao X, Lin S, Peng Q, Shi S, Wei X, Zhang T, et al. DNA nanostructures: Tetrahedral DNA nanostructure: A potential promoter for cartilage tissue regeneration via regulating chondrocyte phenotype and proliferation. Small. 2017; 13:12. https://doi.org/10.1002/smll.201602770 PMid:28112870

49. Ma W, Shao X, Zhao D, Li Q, Liu M, Zhou T, et al. Self-assembled tetrahedral DNA nanostructures promote neural stem cell proliferation and neuronal differentiation. ACS Appl Mater Interface. 2018; 10 (9):7892-900. https://doi.org/10.1021/acsami.8b00833 PMid:29424522

50. Zhang Q, Lin S, Shi S, Zhang T, Ma Q, Tian T, et al. Anti-inflammatory and anti-oxidative effects of tetrahedral DNA nanostructures via the modulation of macrophage responses. ACS Appl Mater Interface. 2018; 10 (4):3421-30. https://doi.org/10.1021/acsami.7b17928 PMid:29300456

51. Xie X, Shao X, Ma W, Zhao D, Shi S, Li Q, et al. Overcoming drug-resistant lung cancer by paclitaxel loaded tetrahedral DNA nanostructures. Nanoscale. 2018; 10 (12):5457-65. https://doi.org/10.1039/C7NR09692E PMid:29484330

52. El-Sagheer AH, Brown T. Click chemistry with DNA. Chem Soc Rev. 2010; 39:1388-405. https://doi.org/10.1039/b901971p PMid:20309492

53. Li J, Fan C, Pei H, Shi J, Huang Q. Smart drug delivery nanocarriers with self-assembled DNA nanostructures. Adv Mater. 2013; 25:4386-96. https://doi.org/10.1002/adma.201300875 PMid:23765613

54. Jiang G, Zhang M, Yue B, Yang M, Carter C, Al-Quran SZ, et al. PTK7: A new biomarker for immunophenotypic characterization of maturing T cells and T cell acute lymphoblastic leukemia. Leuk Res. 2012; 36 (11): 1347-53. https://doi.org/10.1016/j.leukres.2012.07.004 PMid:22898210 PMCid:PMC3447106

55. Yazdian-Robati R, Arab A, Ramezani M, Abnous K, Taghdisi SM. Application of aptamers in treatment and diagnosis of leukemia. Int J Pharm. 2017; 529:44. https://doi.org/10.1016/j.ijpharm.2017.06.058 PMid:28648578

56. Wang YM, Wu Z, Liu SJ, Chu X. Structure-switching aptamer triggering hybridization chain reaction on the cell surface for activatable theranostics. Anal Chem. 2015; 87:6470-74. https://doi.org/10.1021/acs.analchem.5b01634 PMid:26044187

57. Xiang D, Zheng C, Zhou SF, Qiao S, Tran PH, Pu C, et al. Superior performance of aptamer in tumor penetration over antibody. Implication of aptamer-based theranostics in solid tumors. Theranostics. 2015; 5:1083-97. https://doi.org/10.7150/thno.11711 PMid:26199647 PMCid:PMC4508498

58. Dou S, Virostko J, Greiner DL, Powers AC, Liu G. A feasible approach to evaluate the relative reactivity of NHS-ester activated group with primary amine-derivatized DNA analogue and non-derivatized impurity. Nucleosides Nucleotides Nucleic Acids. 2015; 34 (2):69-78. https://doi.org/10.1080/15257770.2014.958236 PMid:25621701 PMCid:PMC4398971

59. Chen S, Wang L, Fahmi NE, Benkovic SJ, Hecht SM. Two pyrenylalanines in dihydrofolate reductase form an excimer enabling the study of protein dynamics. J Am Chem Soc. 2012; 134 (46):18883-5. https://doi.org/10.1021/ja307179q PMid:23116258 PMCid:PMC3546169

60. Chen S, Fahmi NE, Wang L, Bhattacharya C, Benkovic SJ, Hecht SM. Detection of dihydrofolate reductase conformational change by FRET using two fluorescent amino acids. J Am Chem Soc. 2013; 135 (35):12924-7. https://doi.org/10.1021/ja403007r PMid:23941571 PMCid:PMC3785542

61. Chen S, Zhang Y, Hecht SM. p-Thiophenylalanine-induced DNA cleavage and religation activity of a modified vaccinia topoisomerase IB. Biochem. 2011; 50 (43):9340-51. https://doi.org/10.1021/bi201291p PMid:21942719

62. Chen S, Hecht SM. Synthesis of pdCpAs and transfer RNAs activated with derivatives of aspartic acid and cysteine. Bioorg Med Chem. 2008; 16 (19): 9023-31. https://doi.org/10.1016/j.bmc.2008.08.036 PMid:18790645

63. Agudelo D, Bourassa P, Berube G, Tajmir-Riahi HA. Intercalation of antitumor drug doxorubicin and its analogue by DNA duplex: structural features and biological implications. Int J Biol Macromol. 2014; 66:144-50. https://doi.org/10.1016/j.ijbiomac.2014.02.028 PMid:24560949

64. Lee DS, Qian H, Tay CY, Leong DT. Cellular processing and destinies of artificial DNA nanostructures. Chem Soc Rev. 2016; 45 (15):4199-225. https://doi.org/10.1039/C5CS00700C PMid:27119124

65. Hu Y, Chen Z, Zhang H, Li M, Hou Z, Luo X, et al. Development of DNA tetrahedron based drug delivery system. Drug Deliv. 2017; 24(1):1295-301. https://doi.org/10.1080/10717544.2017.1373166 PMid:28891335 PMCid:PMC8241089

66. Jorge AF, Eritja R. Overview of DNA self-assembling: Progress in biomedical applications. Pharmaceut. 2018; 10:268. https://doi.org/10.3390/pharmaceutics10040268 PMid:30544945 PMCid:PMC6320858

67. Chen N, Qin S, Yang X, Wang Q, Huang J, Wang K. "Sense and treat" DNA nanodevice for synergistic destruction of circulating tumor cells. ACS Appl Mater Interface. 2016; 8 (40):26552-8. https://doi.org/10.1021/acsami.6b08695 PMid:27653943

68. Kim KR, Bang D, Ahn DR. Nano-formulation of a photosensitizer using a DNA tetrahedron and its potential for in vivo photodynamic therapy. Biomater Sci UK. 2016; 4 (4):605-9. https://doi.org/10.1039/C5BM00467E PMid:26674121

69. Kang JK, Kim KR, Lee H, Ahn DR, Ko YT. In vitro and in vivo behavior of DNA tetrahedron as tumor-targeting nanocarriers for doxorubicin delivery. Colloids Surf B Biointerface. 2017; 157:424-31. https://doi.org/10.1016/j.colsurfb.2017.06.014 PMid:28645043

70. Dai BD, Hu Y, Duan JH, Yang XD. Aptamer-guided DNA tetrahedron as a novel targeted drug delivery system for MUC1-expressing breast cancer cells in vitro. Oncotarget. 2016; 7:38257-69. https://doi.org/10.18632/oncotarget.9431 PMid:27203221 PMCid:PMC5122387

71. Sun P, Zhang N, Tang Y, Yang Y, Chu X, Zhao Y. SL2B aptamer and folic acid dual-targeting DNA nanostructures for synergic biological effect with chemotherapy to combat colorectal cancer. Int J Nanomed. 2017; 12:2657-72. https://doi.org/10.2147/IJN.S132929 PMid:28435250 PMCid:PMC5388264

72. Kim KR, Kim HY, Lee YD, Ha JS, Kang JH, Jeong H, et al. Self-assembled mirror DNA nanostructures for tumor-specific delivery of anticancer drugs. J Control Rel. 2016; 243:121-31. https://doi.org/10.1016/j.jconrel.2016.10.015 PMid:27746274

73. Setyawati MI, Kutty RV, Tay CY, Yuan X, Xie J, Leong DT. Novel theranostic DNA nanoscaffolds for the simultaneous detection and killing of Escherichia coli and Staphylococcus aureus. ACS Appl Mater Interface. 2014; 6 (24):21822-31. https://doi.org/10.1021/am502591c PMid:24941440

74. Jorge A, Avino A, Pais A, Eritja R, Fabrega C. DNA-based nanoscaffolds as vehicles for 5-fluoro-2׳-deoxyuridine oligomers in colorectal cancer therapy. Nanoscale. 2018; 10:7238-49. https://doi.org/10.1039/C7NR08442K PMid:29632908

75. Li J, Pei H, Zhu B, Liang L, Wei M, He Y, et al. Self-assembled multivalent DNA nanostructures for noninvasive intracellular delivery of immunostimulatory CpG oligonucleotides. ACS Nano. 2011; 5 (11):8783-9. https://doi.org/10.1021/nn202774x PMid:21988181

76. Liu X, Xu Y, Yu T, Clifford C, Liu Y, Yan H, et al. A DNA nanostructure platform for directed assembly of synthetic vaccines. Nano Lett. 2012; 12(8): 4254-9. https://doi.org/10.1021/nl301877k PMid:22746330 PMCid:PMC3808986

77. Keum JW, Ahn JH, Bermudez H. Design, assembly, and activity of antisense DNA nanostructures. Small. 2011; 7:3529-35. https://doi.org/10.1002/smll.201101804 PMid:22025353

78. Readman JB, Dickson G, Coldham NG. Tetrahedral DNA nanoparticle vector for intracellular delivery of targeted peptide nucleic acid antisense agents to restore antibiotic sensitivity in cefotaxime-resistant Escherichia coli. Nucleic Acid Ther. 2017; 27:176-81. https://doi.org/10.1089/nat.2016.0644 PMid:28080251

79. Charoenphol P, Bermudez H. Aptamer-targeted DNA nanostructures for therapeutic delivery. Mol Pharmaceut. 2014; 11(5):1721-5. https://doi.org/10.1021/mp500047b PMid:24739136 PMCid:PMC4018137

80. Kim KR, Lee T, Kim BS, Ahn DR. Utilizing the bioorthogonal base-pairing system of L-DNA to design ideal DNA nanocarriers for enhanced delivery of nucleic acid cargos. Chem Sci. 2014; 5:1533-7. https://doi.org/10.1039/C3SC52601A

81. Meng H, Liong M, Xia T, Li Z, Ji Z, Zink JI, et al. Engineered design of mesoporous silica nanoparticles to deliver doxorubicin and P-glycoprotein siRNA to overcome drug resistance in a cancer cell line. ACS Nano. 2010; 4 (8):4539-50. https://doi.org/10.1021/nn100690m PMid:20731437 PMCid:PMC3899722

82. Matsuzaki H, Schmied BM, Ulrich A, Standop J, Scvhneider MB, Batra SK, et al. Combination of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and actinomycin D induces apoptosis even in TRAIL-resistant human pancreatic cancer cells. Clin Cancer Res. 2001; 7 (2):407-14.

83. Aiuti A, Biasco L, Scaramuzza S, Ferrua F, Cicalese MP, Baricordi C, et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 2013; 341 (6148):1233151. https://doi.org/10.1126/science.1233151 PMid:23845947 PMCid:PMC4375961

84. Kim KR, Kim DR, Lee T, Yhee JY, Kim BS, Kwon IC, et al. Drug delivery by a self-assembled DNA tetrahedron for overcoming drug resistance in breast cancer cells. Chem Commun. 2013; 49 (20):2010-12. https://doi.org/10.1039/c3cc38693g PMid:23380739

85. Lee SY, Kim KR, Bang D, Bae SW, Kim HJ, Ahn DR. Biophysical and chemical handles to control the size of DNA nanoparticles produced by rolling circle amplification. Biomater Sci. 2016; 4(9):1314-7. https://doi.org/10.1039/C6BM00296J PMid:27464359

86. Karpel-Massler G, Ishida CT, Bianchetti E, Shu C, Perez-Lorenzo R, Horst B, et al. Inhibition of mitochondrial matrix chaperones and antiapoptotic Bcl-2 family proteins empower antitumor therapeutic responses. Cancer Res. 2017; 77(13): 3513-26. https://doi.org/10.1158/0008-5472.CAN-16-3424 PMid:28522750 PMCid:PMC5503474

87. Li Q, Zhao D, Shao X, Lin S, Xie X, Liu M, et al. Aptamer-modified tetrahedral DNA nanostructure for tumor-targeted drug delivery. ACS Appl Mater Interface. 2017; 9(42):36695-701. https://doi.org/10.1021/acsami.7b13328 PMid:28991436

88. Meng HM, Liu H, Kuai H, Peng R, Mo L, Zhang XB. Aptamer-integrated DNA nanostructures for biosensing, bioimaging and cancer therapy. Chen Soc Rev. 2016; 45(9):2583-602. https://doi.org/10.1039/C5CS00645G PMid:26954935

89. Ouyang X, Li J, Liu H, Zhao B, Yan J, Ma Y, et al. Rolling circle amplification-based DNA origami nanostructrures for intracellular delivery of immunostimulatory drugs. Small. 2013; 9(18):3082-7. https://doi.org/10.1002/smll.201300458 PMid:23613456

90. Yan Z, Yang Y, Wei X, Zhong J, Wei D, Liu L, et al. Tumor-penetrating peptide mediation: An effective strategy for improving the transport of liposomes in tumor tissue. Mol Pharm. 2014; 11(1):218-25. https://doi.org/10.1021/mp400393a PMid:24325555

91. Zanta MA, Belguise-Valladier P, Behr JP. Gene delivery: a single nuclear localization signal peptide is sufficient to carry DNA to the cell nucleus. Proc Natl Acad Sci USA. 1999; 96(1):91-6. https://doi.org/10.1073/pnas.96.1.91 PMid:9874777 PMCid:PMC15098

92. Zhang Y, Jiang S, Zhang D, Bai X, Hecht SM, Chen S. DNA-affibody nanoparticles for inhibiting breast cancer cells overexpressing HER2. Chem Commun. 2017; 53 (3):573-6. https://doi.org/10.1039/C6CC08495H PMid:27975087

93. Rosenberg SA, Yang JC, Restifo NP. Cancer immunotherapy: moving beyond current vaccines. Nat Med. 2004; 10 (9):909-15. https://doi.org/10.1038/nm1100 PMid:15340416 PMCid:PMC1435696

94. Mellman I, Coukos G, Dranoff G. Cancer immunotherapy comes of age. Nature. 2011; 480 (7378):480-9. https://doi.org/10.1038/nature10673

PMid:22193102 PMCid:PMC3967235

95. Li W, Luo L, Huang J, Wang Q, Liu J, Xiao X, et al. Self-assembled DNA nanocentipedes as multivalent vehicles for enhanced delivery of CpG oligonucleotides. Chem Commun (Camb). 2017; 53 (40):5565-8. https://doi.org/10.1039/C7CC01128H PMid:28475186

96. Niemeyer CM, Sano T, Smith CL, Cantor CR. Oligonucleotide-directed self-assembly of proteins: Semisynthetic DNA-streptavidin hybrid molecules as connectors for the generation of macroscopic arrays and the construction of supramolecular bioconjugates. Nucleic Acids Res. 1994; 22:5530-9. https://doi.org/10.1093/nar/22.25.5530 PMid:7530841 PMCid:PMC310113

97. Rosen CB, Kodal AL, Nielsen JS, Schaffert DH, Scavenius C, Okholm AH, et al. Template-directed covalent conjugation of DNA to native antibodies, transferin and other metal-binding proteins. Nat Chem. 2014; 6 (9):804-9. https://doi.org/10.1038/nchem.2003 PMid:25143216

98. Vollmer J, Krieg AM. Immunotherapeutic applications of CpG oligodeoxynucleotide TLR9 agonists. Adv Drug Deliv Rev. 2009; 61 (3):195-204. https://doi.org/10.1016/j.addr.2008.12.008 PMid:19211030

99. Hartmann G, Weiner GJ, Krieg AM. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc Natl Acad Sci USA. 1999; 96 (16):9305-10. https://doi.org/10.1073/pnas.96.16.9305 PMid:10430938 PMCid:PMC17777

100. Weber PC, Pantoliano MW, Thompson LD. Crystal structure and ligand-binding studies of a screened peptide complexed with streptavidin. Biochem. 1992; 31(39):9350-4. https://doi.org/10.1021/bi00154a004 PMid:1390720

101. Hendrickson WA, Pahler A,. Smith JL, Satow Y, Merritt EA, Phizackerley RP. Crystal structure of core streptavidin determined from multiwavelength anomalous diffraction of synchrotron radiation. Proc Natl Acad Sci USA. 1989; 86(7):2190-4. https://doi.org/10.1073/pnas.86.7.2190 PMid:2928324 PMCid:PMC286877

102. Voigt NV, Tørring T, Rotaru A, Jacobsen MF, Ravnsbaek JB, Subramani R, et al. Single-molecule chemical reactions on DNA origami. Nat Nanotechnol. 2010; 5(3):200-3. https://doi.org/10.1038/nnano.2010.5 PMid:20190747

103. Zhang L, Zhu G, Mei L, Wu C, Qiu L, Cui C, et al. Self-assembled DNA immunonanoflowers as multivalent CpG nanoagents. ACS Appl Mater Interface. 2015; 7:24069-74. https://doi.org/10.1021/acsami.5b06987 PMid:26440045 PMCid:PMC4898273

104. Dowdy SF. Overcoming cellular barriers for RNA therapeutics. Nat Biotechnol. 2017; 35:222-9. https://doi.org/10.1038/nbt.3802 PMid:28244992

105. Lieberman J. Tapping the RNA world for therapeutics. Nat Struct Mol Biol. 2018; 25:357-64. https://doi.org/10.1038/s41594-018-0054-4 PMid:29662218 PMCid:PMC6052442

106. Hannon GJ. RNA interference. Nature. 2002; 418:244-51. https://doi.org/10.1038/418244a PMid:12110901

107. Sachdeva M, Mo YY. miR-145-mediated suppression of cell growth, invasion and metastasis. Am J Transl Res. 2010; 2 (2): 170-80.

108. Fuse M, Nohata N, Kojima S, Sakamoto S, Chiyomaru T, Kawakami K, et al. Restoration of miR-145-expression suppresses cell proliferation, migration and invasion in prostate cancer by targeting FSCN1. Int J Oncol. 2011; 38 (4): 1093-101. https://doi.org/10.3892/ijo.2011.919

109. Hsu PD, Lander ES, Zhang F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 2014; 157: 1262-78. https://doi.org/10.1016/j.cell.2014.05.010 PMid:24906146 PMCid:PMC4343198

110. Ran FA, Hsu PD, Lin CY, Gootenberg JS, Konermann S, Trevino AE, et al. Double nicking by RNA-guided CRISPR-Cas9 for enhanced genome editing specificity. Cell. 2013; 154 (6):1380-9. https://doi.org/10.1016/j.cell.2013.08.021 PMid:23992846 PMCid:PMC3856256

111. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014; 343 (6166):84-7.https://doi.org/10.1126/science.1247005 PMid:24336571 PMCid:PMC4089965

112. Doudna JA, Charpentier E. The new frontier of genome engineering with CRISPR-Cas9. Science. 2014; 346:1258096. https://doi.org/10.1126/science.1258096 PMid:25430774

113. Sun W, Ji W, Hall JM, Hu Q, Wang C, Beisel CL, et al. Self-assembled DNA nanoclews for the efficient delivery of CRISPR-Cas9 for genome editing. Angew Chem Int Ed. 2015; 54:12029-33. https://doi.org/10.1002/anie.201506030 PMid:26310292 PMCid:PMC4677991

114. Varkouhi AK, Scholte M, Storm G, Haisma HJ. Endosomal escape pathways for delivery of biological. J Cont Rel. 2011; 151: 220-8. https://doi.org/10.1016/j.jconrel.2010.11.004 PMid:21078351

115. Dolmas DEJGJ, Fukumura D, Jain RK. Photodynamic therapy for cancer. Nat Rev Cancer. 2003; 3 (5):380-7. https://doi.org/10.1038/nrc1071 PMid:12724736

116. He X, Wu X, Wang K, Shi B, Hai L. Methylene blue-encapsulated phosphonate-terminated silica nanoparticles for simultaneous in vivo imaging and photodynamic therapy. Biomater. 2009; 30 (29):5601-9. https://doi.org/10.1016/j.biomaterials.2009.06.030 PMid:19595455

117. Du Y, Jiang Q, Beziere N, Song L, Zhang Q, Peng D, et al. DNA-nanostructure-gold nanorod hybrids for enhanced in vivo optoacoustic imaging and photothermal therapy. Adv Mater. 2016; 28: 10000-7. https://doi.org/10.1002/adma.201601710 PMid:27679425

118. Jiang Q, Shi Y, Zhang Q, Li N, Zhan P, Song L, et al. A self-assembled DNA origami-gold nanorod complex for cancer theranostics. Small. 2015; 11:5134-41. https://doi.org/10.1002/smll.201501266 PMid:26248642

119. Song L, Jiang Q, Liu J, Li N, Liu Q, Dai L, et al. DNA origami / gold nanorod hybrid nanostructures for the circumvention of drug resistance. Nanoscale. 2017; 9:7750-4. https://doi.org/10.1039/C7NR02222K PMid:28581004

120. Thomas TP, Huang BH, Choi SK, Silpe JE, Kotlyar A, Desai AM, et al. Polyvalent dendrimer-methotrexate as a folate receptor-targeted cancer therapeutic. Mol Pharmaceut. 2012; 9 (9):2669-76. https://doi.org/10.1021/mp3002232 PMid:22827500 PMCid:PMC4457335

121. Jiang D, Sun Y, Li J, Li Q, Lv M, Zhu B, et al. Multiple-armed tetrahedral DNA nanostructures for tumor-targeting, dual-modality in vivo imaging. ACS Appl Mater Interface. 2016; 8 (7):4378-84. https://doi.org/10.1021/acsami.5b10792 PMid:26878704

122. Rogers LM, Pfeiffer CM, Bailey LB, Gregory JF. A dual-label stable-isotopic protocol is suitable for determination of folate bioavailability in humans: evaluation of urinary excretion and plasma folate kinetics of intravenous and oral doses of [13C5] and [2H2] folic acid. J Nutr. 1997; 127 (12):2321-7. https://doi.org/10.1093/jn/127.12.2321 PMid:9405581

123. Huang Y, Huang W, Chan L, Zhou B, Chen T. A multifunctional DNA origami as carrier of metal complexes to achieve enhanced tumoral delivery and nullified systemic toxicity. Biomater. 2016; 103:183-96. https://doi.org/10.1016/j.biomaterials.2016.06.053 PMid:27388944

124. Hahn J, Wickham SF, Shih WM, Perrault SD. Addressing the instability of DNA nanostructures in tissue culture. ACS Nano. 2014; 8 (9):8765-75. https://doi.org/10.1021/nn503513p PMid:25136758 PMCid:PMC4174095

125. Keun JW, Bermudez H. Enhanced resistance of DNA nanostructures to enzymatic digestion. Chem Commun. 2009; 7:7036-8. https://doi.org/10.1039/b917661f PMid:19904386

126. Perrault SD, Shih WM. Virus-inspired membrane encapsulation of DNA nanostructures to achieve in vivo stability. ACS Nano. 2014; 8:5132-40. https://doi.org/10.1021/nn5011914 PMid:24694301 PMCid:PMC4046785


 

 

 


Parse error: Unclosed '(' on line 53325 in /home/jddtonline/domains/jddtonline.info/public_html/cache/fc-geoIP-all.php on line 53328